View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13733_low_17 (Length: 275)
Name: NF13733_low_17
Description: NF13733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13733_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 46 - 260
Target Start/End: Original strand, 14810508 - 14810722
Alignment:
| Q |
46 |
ggttggtcccgcatggttcctgcccgatattttttgagttacttttgtttttggaactggcctaccctactctttttcattggcaattaagaattatcct |
145 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14810508 |
ggttggtcccgcatgattcctgcccgatattttttgagttacttttgtttttggcactggcctaccctactctttttcattggcaattaagaattatcct |
14810607 |
T |
 |
| Q |
146 |
ttttgtttgtactattagcgataacgataccttaaattaatggcttaataatcaagacaagattatattttgtcatgaaccaggccttgacgaggtaaaa |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14810608 |
ttttgtttgtactattagcgataacgataccttaaattaatggcttaataatcaagacaagattatattttgtcatgaaccaagccttgacgaggtaaaa |
14810707 |
T |
 |
| Q |
246 |
tgtttgtgggttcat |
260 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14810708 |
tgtttgtgggttcat |
14810722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University