View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13733_low_19 (Length: 256)
Name: NF13733_low_19
Description: NF13733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13733_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 2 - 245
Target Start/End: Complemental strand, 13798818 - 13798574
Alignment:
| Q |
2 |
tttttagaaagattttgatgttnnnnnnncaattgtcaaaacacaaaccgcttattacaatttagccaattatatctatgtctccgtcttgacaaaagaa |
101 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
13798818 |
tttttagaaagattttgatgttaaaaaagaaattgtcaacacacaaaccgcttattacaatttgaccaattatatctatgtctccgtcttgacaaaaaaa |
13798719 |
T |
|
| Q |
102 |
ataaaaaa-tctacgtctccnnnnnnntgtaactattgtacgttttttattatacaatacattgcaccatttaaatattacgatctaaattacaggttta |
200 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13798718 |
ataaaaaaatctacgtctccaaaaaaatgtaactgttgtaggttttttattatacaatacattgcaccatttaaatattacgatctaaattagaggttta |
13798619 |
T |
|
| Q |
201 |
atttgaaccgctcaattatgtttgtagactttaaactccgttcat |
245 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13798618 |
atttgaaccgctcaattatatttgtagactttaaactccgttcat |
13798574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University