View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13733_low_21 (Length: 246)
Name: NF13733_low_21
Description: NF13733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13733_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 42600781 - 42600564
Alignment:
| Q |
13 |
aatattaacgatgataccaccttgaaccgggttaacatcaacccactcaccttcatacttcacctgcaatcccggaacctgattctgcaacaacaaagta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600781 |
aatattaacgatgataccaccttgaaccgggttaacatcaacccactcaccttcatacttcacctgcaatcccggaacctgattctgcaacaacaaagta |
42600682 |
T |
 |
| Q |
113 |
atagcacaaggatctgtatgcggtgtaatacccatagtcaaatctggttgaggacaataaggataacaatgtcccacaatcaccctcgtttcacaaaaac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600681 |
atagcacaaggatctgtatgcggtgtaatacccatagtcaaatctggttgaggacaataaggataacaatgtcccacaatcaccctcgtttcacaaaaac |
42600582 |
T |
 |
| Q |
213 |
tcaactccttcaactttc |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42600581 |
tcaactccttcaactttc |
42600564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University