View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13734_high_17 (Length: 402)
Name: NF13734_high_17
Description: NF13734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13734_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 18 - 324
Target Start/End: Complemental strand, 394843 - 394538
Alignment:
| Q |
18 |
gaattctcattcctttccatatcaagcggatactgtatcacgtggatttccgggaaagctccaccttcaccgaaatcctcaaccggatcgtttcagatac |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394843 |
gaattctcattcctttccatatcaagtggatactgtatcacgtggatttccgggaaagctccaccttcaccgaaatcctcaaccggatcgtttcagatac |
394744 |
T |
 |
| Q |
118 |
ggtggtacaattgatttctcctcttcggttgcggtgaacagttgcttaaaccaaggatcgtagctatggtgatagtatgttgctgtagatgattttggtt |
217 |
Q |
| |
|
||||||||||||| || |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394743 |
ggtggtacaattggtt-ctcctctttggttgtggtgaacagttgcttaaaccaaggatcgtagctatggtgatagtatgttgctgtagatgattttggtt |
394645 |
T |
 |
| Q |
218 |
ccggaaggagttccttcagagcctccatggttttatgaacagtggaggacggtggggtggggtacggcagcgcaggaggaagacgtttggtgtgtttcta |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394644 |
ccggaaggagttccttcagagcctccatggttttatgaacagtggaggacggtggggtgaggtacggcagcgcaggaggaagacgtttggtgtgtttcta |
394545 |
T |
 |
| Q |
318 |
ctttcta |
324 |
Q |
| |
|
||||||| |
|
|
| T |
394544 |
ctttcta |
394538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 130 - 249
Target Start/End: Original strand, 11456085 - 11456204
Alignment:
| Q |
130 |
gatttctcctcttcggttgcggtgaacagttgcttaaaccaaggatcgtagctatggtgatagtatgttgctgtagatgattttggttccggaaggagtt |
229 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||||||| ||||||| |||||| | ||||||||||| ||| |||||||||||||| |||||||||| |
|
|
| T |
11456085 |
gatttctcctcttccgttgcagtgaatctttgcttaaaccatggatcgttgctatgatcatagtatgttgttgtggatgattttggttctggaaggagtt |
11456184 |
T |
 |
| Q |
230 |
ccttcagagcctccatggtt |
249 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
11456185 |
ccttcagagccgccatggtt |
11456204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 11455938 - 11456021
Alignment:
| Q |
18 |
gaattctcattcctttccatatcaagcggatactgtatcacgtggatttccgggaaagctccaccttcaccgaaatcctcaacc |
101 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||| ||| ||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
11455938 |
gaattcttattccttcccatatcaagcggatactgtgccacatggatctccgggaaagctccaccttctccaaaatcctcaacc |
11456021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University