View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13734_high_29 (Length: 347)
Name: NF13734_high_29
Description: NF13734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13734_high_29 |
 |  |
|
| [»] scaffold0021 (3 HSPs) |
 |  |  |
|
| [»] scaffold0416 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 148 - 337
Target Start/End: Complemental strand, 10972695 - 10972506
Alignment:
| Q |
148 |
aattttgagtttgatggtgcgaaatgggagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcctactttac |
247 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||| ||||| |||||||| |||| ||||||||||||| ||||| |
|
|
| T |
10972695 |
aattttgagtttggcggtgcgggatgggagttcatcggggttccaacctagttgggatgccgttgtttcttcttgatgtttgtcctttctcctgttttac |
10972596 |
T |
 |
| Q |
248 |
ctnnnnnnntaatggtcaaagttaattaatattcatctcatgtgatccctaaattatactctcccatactatttctctaccatgcctttg |
337 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10972595 |
ctaaaaaaataatggtcaaagttaattaatattcatctcacgtgatccctaaataatactctcccatactatttctctaccatgcctttg |
10972506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 240
Target Start/End: Original strand, 19185093 - 19185162
Alignment:
| Q |
171 |
atgggagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcct |
240 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||| ||||||||||| ||| ||| |||||| |||||| |
|
|
| T |
19185093 |
atgggagttcttcggggtgccaacctagttgggatgtcgttgcttctccttgatgcctgtcctctctcct |
19185162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 106; Significance: 5e-53; HSPs: 3)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 187 - 337
Target Start/End: Complemental strand, 118703 - 118553
Alignment:
| Q |
187 |
gttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcctactttacctnnnnnnntaatggtcaaagttaattaatattcatctc |
286 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||| || ||||| || |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
118703 |
gttccaacctagttgggatgtcgttgcttcttcttgatgtatatcatttcttctgctttacctaaaaaaataatggtcaaagttaattaatattcatctc |
118604 |
T |
 |
| Q |
287 |
atgtgatccctaaattatactctcccatactatttctctaccatgcctttg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
118603 |
atgtgatccctaaattatactctcccatactatttctctaccatgcctttg |
118553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 144 - 185
Target Start/End: Complemental strand, 120153 - 120112
Alignment:
| Q |
144 |
aattaattttgagtttgatggtgcgaaatgggagttcatcgg |
185 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
120153 |
aattaattttgagtttgatggtgcggaatgggagttcatcgg |
120112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 22 - 53
Target Start/End: Complemental strand, 120273 - 120242
Alignment:
| Q |
22 |
tagatatccgtaggtggatgtttatgcttatc |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
120273 |
tagatatccgtaggtggatgtttatgcttatc |
120242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 151 - 249
Target Start/End: Original strand, 16987809 - 16987907
Alignment:
| Q |
151 |
tttgagtttgatggtgcgaaatgggagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcctactttacct |
249 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| || |||||||||||||||| ||||||||||| ||| |||| |||| |||||||| |||||||| |
|
|
| T |
16987809 |
tttgagtttggcggtgcgggatgggagttcatcggggtgccaacctagttgggatgtcgttgcttctccttgatgtctgtcttttctcctgctttacct |
16987907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 146 - 248
Target Start/End: Complemental strand, 31552484 - 31552383
Alignment:
| Q |
146 |
ttaattttgagtttgatggtgcgaaatgggagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcctacttt |
245 |
Q |
| |
|
||||||||||||||| ||||| ||| |||||||| | || |||||||||||||||| ||||||||||| ||| ||| |||||| |||||| |||| |
|
|
| T |
31552484 |
ttaattttgagtttggcagtgcgggatgagagttcattgaggtgccaacctagttgggatgtcgttgcttctccttgatg-ctgtcctctctcctgcttt |
31552386 |
T |
 |
| Q |
246 |
acc |
248 |
Q |
| |
|
||| |
|
|
| T |
31552385 |
acc |
31552383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 257 - 330
Target Start/End: Original strand, 74450 - 74523
Alignment:
| Q |
257 |
taatggtcaaagttaattaatattcatctcatgtgatccctaaattatactctcccatactatttctctaccat |
330 |
Q |
| |
|
|||| ||||||| ||||||||| |||||||| |||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
74450 |
taatagtcaaagctaattaataatcatctcacgtgacccctaaattatactctcccacactatttctctaccat |
74523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 150 - 249
Target Start/End: Original strand, 44395754 - 44395852
Alignment:
| Q |
150 |
ttttgagtttgatggtgcgaaatgggagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcctactttacct |
249 |
Q |
| |
|
||||||||||| |||||| |||| ||||||||| || |||||||||||||||| ||||||||||| ||| |||| ||||||||||||| |||||||| |
|
|
| T |
44395754 |
ttttgagtttggcggtgcgggatggacgttcatcggggtaccaacctagttgggatgtcgttgcttctccttgatgt-tgtcctttctcctgctttacct |
44395852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 240
Target Start/End: Complemental strand, 16110011 - 16109942
Alignment:
| Q |
171 |
atgggagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcct |
240 |
Q |
| |
|
|||||||||||| || || |||||||||||||||| ||||||||||| | |||| ||||||||||||| |
|
|
| T |
16110011 |
atgggagttcattggggtgccaacctagttgggatgtcgttgcttctccccgatgtttgtcctttctcct |
16109942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 175 - 226
Target Start/End: Complemental strand, 3914302 - 3914251
Alignment:
| Q |
175 |
gagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgt |
226 |
Q |
| |
|
||||||||||| || |||||||||||||||| ||||||||||| ||| |||| |
|
|
| T |
3914302 |
gagttcatcggggtgccaacctagttgggatgtcgttgcttctccttgatgt |
3914251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0416 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0416
Description:
Target: scaffold0416; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 154 - 249
Target Start/End: Original strand, 14810 - 14904
Alignment:
| Q |
154 |
gagtttgatggtgcgaaatgggagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcctactttacct |
249 |
Q |
| |
|
||||||| |||||| ||||||||||||||| || |||||||||||||||| ||||||||||| ||| ||| |||||| |||||| |||||||| |
|
|
| T |
14810 |
gagtttggcggtgcgggatgggagttcatcggggtgccaacctagttgggatgtcgttgcttctccttgatg-ctgtcctctctcctgctttacct |
14904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 171 - 249
Target Start/End: Complemental strand, 16932624 - 16932546
Alignment:
| Q |
171 |
atgggagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcctactttacct |
249 |
Q |
| |
|
||||||||||||||| || ||||| ||||||| || |||||| |||| ||| ||||||||||| ||||||| ||||||| |
|
|
| T |
16932624 |
atgggagttcatcggggtgccaacatagttggaatgtcgttgtttctccttgatgtatgtcctctctcctagtttacct |
16932546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 249
Target Start/End: Original strand, 13779081 - 13779139
Alignment:
| Q |
191 |
caacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcctactttacct |
249 |
Q |
| |
|
|||| |||||||||| ||||||||| ||||| ||| |||||||||||||| |||||||| |
|
|
| T |
13779081 |
caacttagttgggatgtcgttgctttttcttgatgcatgtcctttctcctgctttacct |
13779139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 249
Target Start/End: Complemental strand, 29600478 - 29600401
Alignment:
| Q |
171 |
atgggagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcctactttacct |
249 |
Q |
| |
|
||||||||||||||| || |||||||| || |||| ||||||||||| ||||||| |||||| |||||| |||||||| |
|
|
| T |
29600478 |
atgggagttcatcggggtgccaacctaattaggatgtcgttgcttctccttaatg-ctgtcctctctcctgctttacct |
29600401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 217
Target Start/End: Complemental strand, 27845764 - 27845718
Alignment:
| Q |
171 |
atgggagttcatcggagttccaacctagttgggatttcgttgcttct |
217 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| || |||||||| |
|
|
| T |
27845764 |
atgggagttcatcggggttccaacctagttgggatatctttgcttct |
27845718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 238
Target Start/End: Complemental strand, 2040133 - 2040072
Alignment:
| Q |
177 |
gttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctc |
238 |
Q |
| |
|
||||||||| | |||||||||||||||| ||| |||| | |||| |||||||||||||||| |
|
|
| T |
2040133 |
gttcatcgggatgccaacctagttgggatgtcggtgctacctcttcatgtatgtcctttctc |
2040072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 240
Target Start/End: Original strand, 33012771 - 33012840
Alignment:
| Q |
171 |
atgggagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcct |
240 |
Q |
| |
|
||||||||||| || || |||||||||||||||| ||||||||||| ||| |||| |||||| |||||| |
|
|
| T |
33012771 |
atgggagttcaacgaggtgccaacctagttgggatgtcgttgcttctccttgatgtttgtcctctctcct |
33012840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 190 - 241
Target Start/End: Original strand, 17122865 - 17122916
Alignment:
| Q |
190 |
ccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctccta |
241 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||| |||| ||||| |||||||| |
|
|
| T |
17122865 |
ccaacctagttgggatgtcgttgcttctccttgatgtctgtccattctccta |
17122916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 240
Target Start/End: Original strand, 24230198 - 24230267
Alignment:
| Q |
171 |
atgggagttcatcggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcct |
240 |
Q |
| |
|
|||||| |||||||| || ||||||||||||||| ||||||||||| ||| ||| |||||| |||||| |
|
|
| T |
24230198 |
atgggaattcatcggggtgtcaacctagttgggatgtcgttgcttctccttgatgcctgtcctctctcct |
24230267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 9344507 - 9344564
Alignment:
| Q |
183 |
cggagttccaacctagttgggatttcgttgcttcttcttaatgtatgtcctttctcct |
240 |
Q |
| |
|
|||||| |||||||||||||||| |||||| || |||| ||||||||| |||||||| |
|
|
| T |
9344507 |
cggagtgccaacctagttgggatgtcgttgttttctcttgatgtatgtcatttctcct |
9344564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University