View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13734_high_41 (Length: 273)
Name: NF13734_high_41
Description: NF13734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13734_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 110 - 260
Target Start/End: Original strand, 14769459 - 14769611
Alignment:
| Q |
110 |
taagggaaggatcaagcctctcctgtacgtaaaaactatcataatttcctgtacatattatgacggagaaaactggattacaagtttcaccttttgaatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14769459 |
taagggaaggatcaagcctctcctgtacgtaaaaactatcataatttcctgtacatattatgatggagaaaactggattacaagtttcatcttttgaatt |
14769558 |
T |
 |
| Q |
210 |
-aaaaatctgcactgatgtgg-atgaaatgctcgtgttataatttttgttata |
260 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14769559 |
aaaaaatctgcactgatgtggaatgaaatgctcgtgttataatttttgttata |
14769611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University