View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13734_high_43 (Length: 258)
Name: NF13734_high_43
Description: NF13734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13734_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 44911043 - 44911268
Alignment:
| Q |
20 |
actaatacattgtaacgcaagaattgcagctgtataagccgccctttgtggatactgcccttgtaatcttgtgtccataatccgaaacaactttcttcta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44911043 |
actaatacattgtaacgcaagaattgcagctgtataagccgccctttgtggatactgcccttgtaatcttgtgtccataatccgaaacaactttcttcta |
44911142 |
T |
 |
| Q |
120 |
tcacccaagtatggtcttgcccaatctaccagattatgttccgctcctgattttgttttatcaacagcattgcgccctgatagtagttccaatagcacaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44911143 |
tcacccaagtatggtcttgcccaatctaccagattatgttccgctcctgattttgttttatcaacagcattgcgccctgatagtagttccaatagcacaa |
44911242 |
T |
 |
| Q |
220 |
ctccgaagctatagacatcgcacctt |
245 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44911243 |
ctccgaagctatagacatcgcacctt |
44911268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University