View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13734_low_22 (Length: 385)
Name: NF13734_low_22
Description: NF13734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13734_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 4e-48; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 18 - 138
Target Start/End: Complemental strand, 19740801 - 19740683
Alignment:
| Q |
18 |
gcaagaccctatcatcaatcatatcaagttatttttccattttatgcattgatctataatacctctaagattaaatatattgtatagtatatatatgagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
19740801 |
gcaagaccctatcatcaatcatatcaagttatttttccattttatgcattgat--ataataccttcaagattaaatatattatatagtatatatatgagt |
19740704 |
T |
 |
| Q |
118 |
gatgatatttcaattcaacat |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19740703 |
gatgatatttcaattcaacat |
19740683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 209 - 268
Target Start/End: Complemental strand, 19740604 - 19740545
Alignment:
| Q |
209 |
cgttattcaaataaatatatgagaaagtatatggttcggtctttttatggtcgtgttatt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19740604 |
cgttattcaaataaatatatgagaaagtatatggttcggtctttttatggttgtgttatt |
19740545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 340 - 385
Target Start/End: Complemental strand, 19740477 - 19740432
Alignment:
| Q |
340 |
tacatcttacactcattttattgttttcgaaatgatgttcttatat |
385 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
19740477 |
tacatcttacactcattttatggttttcgaaatgacgttcttatat |
19740432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University