View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13734_low_29 (Length: 367)
Name: NF13734_low_29
Description: NF13734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13734_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 12 - 349
Target Start/End: Original strand, 43805223 - 43805560
Alignment:
| Q |
12 |
attatactaatggcaaaaaatggagaaacagtggctgcttttgaacggttctggtaaagactaactgggggcttgaagttgtcaaccaattattaaaatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805223 |
attatactaatggcaaaaaatggagaaacagtggctgcttttgaacggttctggtaaagactaactgggggcttgaagttgtcaaccaattattaaaatg |
43805322 |
T |
|
| Q |
112 |
ttatcaaaacttcttttcatcttatctaccaccactttgcttatgaaaaatcagaagcagcctcattttcatcgaaaacatgtttctttcatcccttccc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805323 |
ttatcaaaacttcttttcatcttatctaccaccactttgcttatgaaaaatcagaagcagcctcattttcatcgaaaacatgtttctttcatcccttccc |
43805422 |
T |
|
| Q |
212 |
ctgtttctcattttcacactcatcttcattctctccgccatcaccttgttcctccgtcgtaaacaaccaaaatatgaccggagacaaccaccaggtccac |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805423 |
ctgtttctcattttcacactcatcttcattctctccgccatcaccttgttcctccgtcgtaaacaaccaaaatatgaccggagacaaccaccaggtccac |
43805522 |
T |
|
| Q |
312 |
ggggatatccagtcatcggtaacctccacatgctgggt |
349 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43805523 |
ggggatatccagtcatcggtaacctccacttgctgggt |
43805560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University