View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13734_low_58 (Length: 202)
Name: NF13734_low_58
Description: NF13734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13734_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 32 - 188
Target Start/End: Complemental strand, 40392254 - 40392098
Alignment:
| Q |
32 |
gtatgaagtgatcgagatcgacattagacgctgccattgaacaaagacaacaatgtagatgcaaataaattaaaatatcttttgtgcttaataagcagaa |
131 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40392254 |
gtatgaagtgatcgagatcgacattagactctgccattgaacaaagacaacaatgtagatgcaaataaattaaaatatcttttgtgcttaataagcagaa |
40392155 |
T |
 |
| Q |
132 |
ctagtaagcatcattatcccttagttcatgttaatcaacaaccacattgaagtttct |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40392154 |
ctagtaagcatcattatcccttaattcatgttaatcaacaaccacattgaagtttct |
40392098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 69 - 102
Target Start/End: Original strand, 41052100 - 41052133
Alignment:
| Q |
69 |
tgaacaaagacaacaatgtagatgcaaataaatt |
102 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
41052100 |
tgaacaaagacaacaatgtatatgcaaataaatt |
41052133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University