View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13735_high_11 (Length: 318)
Name: NF13735_high_11
Description: NF13735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13735_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 16 - 302
Target Start/End: Original strand, 42980369 - 42980665
Alignment:
| Q |
16 |
aatatcactgtcaagaaatgaaaataagaaaccttttaatatatggggaatcagtccaatagaatagacc----------gtgttcgacattaattgaaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42980369 |
aatatcactgtcaagaaatgaaaataagaaaccttttaatatatggggaatcagtccaatagaatagacctcaatagaacgtgttcgacattaattgaaa |
42980468 |
T |
|
| Q |
106 |
ataatatacctgcatgtcttccaaatatatggaatccctgtaacattggcatgaagcgccttctgcacttctggacgattgaaatacacatcagaatgcc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42980469 |
ataatatacctgcatgtcttccaaatatatggaatccctgtaacattggcatgaagcgccttctgcacttctggacgattgaaatacacatcagaatgcc |
42980568 |
T |
|
| Q |
206 |
tttcggtacacggatcatatgctctagacatccatggctgtttgttttataagatgaaaagaaatcaaacacgattggttgcactcacaattggtaa |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42980569 |
tttcggtacacggatcatatgctctagacatccatggctgtttgttttataagatgaaaagaaatcaaacacgattggttgcactcacaattggtaa |
42980665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 111 - 245
Target Start/End: Original strand, 42974030 - 42974164
Alignment:
| Q |
111 |
atacctgcatgtcttccaaatatatggaatccctgtaacattggcatgaagcgccttctgcacttctggacgattgaaatacacatcagaatgcctttcg |
210 |
Q |
| |
|
||||||||||| ||||||| ||||| |||||| || |||||||||||||| |||||||| ||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
42974030 |
atacctgcatgccttccaagcatatgaaatcccagttacattggcatgaagtgccttctgaacttctggacgattgaagtacacatcagaatacctttca |
42974129 |
T |
|
| Q |
211 |
gtacacggatcatatgctctagacatccatggctg |
245 |
Q |
| |
|
| ||| ||||||||||||||| ||||||| ||||| |
|
|
| T |
42974130 |
gcacaaggatcatatgctctatacatccaaggctg |
42974164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University