View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13735_low_18 (Length: 242)
Name: NF13735_low_18
Description: NF13735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13735_low_18 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 784361 - 784586
Alignment:
| Q |
17 |
aagtttaagccattcacttacgaattacgaacagctttgctcaaagttgatgatgacacaaatgtttttccatcaagatatctattctcttcaataatcc |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
784361 |
aagtttaagcctttcacttacgaattacgaacagctttgctcaaagttgatgatgacacaaatgtttttccatcaagatatctattctcttcaataatcc |
784460 |
T |
 |
| Q |
117 |
tctgtctcattctgatatctaattcttcagcactaaggtccaatggagaatctgaagcctgttataggccaaggaaaaattaacatagaatacttagctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
784461 |
tctgtctcattctgatatctaattcttcagcactaaggtccaatggagaatctgaagcctgttataggccaaggaaaaattaacatagaatacttagctt |
784560 |
T |
 |
| Q |
217 |
tggtcataagaacttgtcaaaacttc |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
784561 |
tggtcataagaacttgtcaaaacttc |
784586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University