View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13735_low_19 (Length: 239)
Name: NF13735_low_19
Description: NF13735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13735_low_19 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 15 - 239
Target Start/End: Original strand, 42980127 - 42980351
Alignment:
| Q |
15 |
atcaaagtagggaatatacattagaggataatgtaagacatgtcaatcaaccaaaagttgatatcacatactgtccatggatgtattgagatgtcaactg |
114 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42980127 |
atcaaagtaggcaatatacattagaggataatgtaagacatgtcaatcaaccaaaagttgatatcacatactgtccatggatgtattgagatgtcaactg |
42980226 |
T |
 |
| Q |
115 |
ttgaattattttcataagtgttgagatatatgtatcttggttaaggtcggtacctgaatacccatatccggagaccagcattgataagttcatgatatat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42980227 |
ttgaattattttcataagtgttgagatatatgtatcttggttaaggtcggtacctgaatacccatatccggagaccagcattgataagttcatgatatat |
42980326 |
T |
 |
| Q |
215 |
aggaagcatagacaatggggaatca |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42980327 |
aggaagcatagacaatggggaatca |
42980351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 163 - 239
Target Start/End: Original strand, 42973840 - 42973916
Alignment:
| Q |
163 |
ggtacctgaatacccatatccggagaccagcattgataagttcatgatatataggaagcatagacaatggggaatca |
239 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42973840 |
ggtacctgtatacccatatccggagatcagcattaataagttcttgatatataggaagcatagacaatggggaatca |
42973916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University