View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13735_low_20 (Length: 235)
Name: NF13735_low_20
Description: NF13735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13735_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 51768147 - 51768365
Alignment:
| Q |
1 |
ctttatttaatttacaattgctgcaactgaaaatgcttcttatactaaattgtatcagatccaaatgactgatgcttacgttggaatatgtgggcaggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51768147 |
ctttatttaatttacaattgctgcaactgaaaatgcttcttatactaaattgtatcagatccaaatgactgatgcatacgttggaatatgtgggcaggaa |
51768246 |
T |
|
| Q |
101 |
ggcaaaacagtgatgaagttgagagattactacgagaatatcaatagtacttcaaatttattaactacttaagatgctttccttttagctttgttctcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51768247 |
ggcaaaacagtgatgaagttgagagattactacgagaatatcaatagtacttcaaatttattaactacttaagatgctttccttttagctttgttctcaa |
51768346 |
T |
|
| Q |
201 |
ta--gagtatttgaattat |
217 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
51768347 |
tattgagtatttgaattat |
51768365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University