View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13735_low_21 (Length: 235)
Name: NF13735_low_21
Description: NF13735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13735_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 36544038 - 36544200
Alignment:
| Q |
1 |
tatattttaatatcctattgagataaagtgaaatctttggtaacatgcaaatatctttaagactctttttggattaatggaaataagcagaatataaatg |
100 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36544038 |
tatattttaatacccttttgagataaagtgaaatctttggtaacatgcaaatatctttaagactctttttggattaatggaaataagcagaatataaatg |
36544137 |
T |
 |
| Q |
101 |
aacgaaatggaatataacatattttgattccattatattgtttgaggattttataatgaaata |
163 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
36544138 |
atcgaaatggaatataacatattttgattccattatattgtttgagtattttataatgtaata |
36544200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 187
Target Start/End: Original strand, 36544229 - 36544257
Alignment:
| Q |
159 |
aaataaatggaataaaatgagttacaata |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36544229 |
aaataaatggaataaaatgagttacaata |
36544257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University