View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13735_low_7 (Length: 456)

Name: NF13735_low_7
Description: NF13735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13735_low_7
NF13735_low_7
[»] chr3 (2 HSPs)
chr3 (181-232)||(35117651-35117702)
chr3 (1-40)||(35117470-35117509)


Alignment Details
Target: chr3 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 181 - 232
Target Start/End: Original strand, 35117651 - 35117702
Alignment:
181 ggaggggttttattgtttttctctgtttcgtctttttcccttgtttagattc 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
35117651 ggaggggttttattgtttttctctgtttcgtctttttcccttgtttagattc 35117702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 35117470 - 35117509
Alignment:
1 tcatcacaaagaatgtccattggatctcccaaaccgttgg 40  Q
    ||||||||||||||||||||||||||||||||||||||||    
35117470 tcatcacaaagaatgtccattggatctcccaaaccgttgg 35117509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University