View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13735_low_7 (Length: 456)
Name: NF13735_low_7
Description: NF13735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13735_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 181 - 232
Target Start/End: Original strand, 35117651 - 35117702
Alignment:
| Q |
181 |
ggaggggttttattgtttttctctgtttcgtctttttcccttgtttagattc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35117651 |
ggaggggttttattgtttttctctgtttcgtctttttcccttgtttagattc |
35117702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 35117470 - 35117509
Alignment:
| Q |
1 |
tcatcacaaagaatgtccattggatctcccaaaccgttgg |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35117470 |
tcatcacaaagaatgtccattggatctcccaaaccgttgg |
35117509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University