View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13735_low_9 (Length: 405)
Name: NF13735_low_9
Description: NF13735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13735_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 2e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 201 - 389
Target Start/End: Complemental strand, 27403886 - 27403699
Alignment:
| Q |
201 |
taaccttcagagacagcttatcatattttcttccttgcttttcagtttccaattccaccccatcccataagcattaccctaattgagggacatgattatc |
300 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27403886 |
taaccttcagagacagctgatcatattttcttccttgcttttcagcttccaattccaccccatcccataagcattaccctaattgagggacatgattatc |
27403787 |
T |
|
| Q |
301 |
ggttttaggttttatctcactttctgtgtatttcgatatcaagactctcaactttgaaaatgtagctagctaggatgatcctatatata |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27403786 |
ggttttaggttttatctcactttctgtgtatttcaatatcaagactctcaactttgaaaatgtagctagcta-gatgatcctatatata |
27403699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University