View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13736_high_8 (Length: 374)
Name: NF13736_high_8
Description: NF13736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13736_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 288
Target Start/End: Original strand, 43383995 - 43384271
Alignment:
| Q |
11 |
gaaccaactgaactcgggctcatagatatattgccctatgacatgagccaaacctttttgcaatgaaccggatcattggctcccatgtcacttccctcct |
110 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43383995 |
gaaccaactgaactcaggctcatagatctattgccctatgacatgagccaaacctttttgcaatgaaccggatcattggctcccatgtcacttccctcct |
43384094 |
T |
|
| Q |
111 |
gggatgcatcccaactagaataaatttacccttaaagtaacattgatggctggccagaacctttatttatactattcgtaannnnnnnnnagagtgtctt |
210 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43384095 |
gggatgcgtcccaactaaaataaatttacccttaaagtaacattgatggttggccagaacctttatttatactattcgtaa-atttttttagagtgtctt |
43384193 |
T |
|
| Q |
211 |
gtaataagggacatagggagtgtatatttcatagacttatctactccaaaaaacaaataaagaatctcaatctttaac |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43384194 |
gtaataagggacatagggagtgtatatttcatagacttatctactccaaaaaacaaataaagaatctcaatctttaac |
43384271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 305 - 357
Target Start/End: Original strand, 34128759 - 34128814
Alignment:
| Q |
305 |
ctagttggagattccgaatttgttccat---tctactcttccaactttctccttca |
357 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34128759 |
ctagttggagattccaaatttgttccatttgtctactcttccaactttctccttca |
34128814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University