View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13736_low_13 (Length: 329)
Name: NF13736_low_13
Description: NF13736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13736_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 5 - 272
Target Start/End: Complemental strand, 36912275 - 36912008
Alignment:
| Q |
5 |
attattctcatatagtcatgtgacactctttattttacggagaatcggagattgtgatctacgttgttctaggctctttaagaaataatgacgttcttta |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36912275 |
attattctcatatagtcatgtgacactctttattttacggagaatcggagattgtgatctatgttgttctaggctctttaagaaataatgacgttcttta |
36912176 |
T |
|
| Q |
105 |
tcttttaacaaagagaaacacaaattgttctttatctaatgtaatcaacaatggaattaaattatcatgagatagacaccgtttcggagaataatttgtc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36912175 |
tcttttaacaaagagaaacacaaattgttctttatctaatgtaatcaacaatggaattaaattatcatgagatagacaccgtttcggagaataatttgtc |
36912076 |
T |
|
| Q |
205 |
aaaatcagttcaatgatagatactgtttcggagaataacaaatctaatcttgtaagggactaaattgg |
272 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
36912075 |
aaaatcagttcaatgatagaaactgtttcggagaataacaagtctaattctgtaagggactaaattgg |
36912008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University