View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13736_low_15 (Length: 294)
Name: NF13736_low_15
Description: NF13736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13736_low_15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 294
Target Start/End: Complemental strand, 8173654 - 8173378
Alignment:
| Q |
18 |
acttgatactggttcgtttaaagcctcaccgacagatctaagttcgacaacaacaccaacagaaactatcgaagaaattttatgtgcctcttgagatcct |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8173654 |
acttggtactggttcgtttaaagcctcaccgacagatctaagttcgacaacaacaccaacagaaactatcgaagaaattttatgtgcctcttgagatcct |
8173555 |
T |
 |
| Q |
118 |
cgaatgcattttcaaagtggcttaccgacttcagttgccaccagagattcgtatccatccagttttttatgttccaaacttgaaaccatttcgcggatct |
217 |
Q |
| |
|
||||||||||| ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8173554 |
cgaatgcatttgcaaagtggcttactgatttcagttgccaccagagattcgtatccatccagttttttatgtttcaaacttgaaaccatttcgcggatct |
8173455 |
T |
 |
| Q |
218 |
gcgttaccattccctcatgttctacctccagacaatatctctaaccaaacctgttgaggtccctgtagcctttgctt |
294 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8173454 |
gcgttacctttccctcatgttctacctccaaacaatatctctaaccaaacctgttgaggtccctgtagccattgctt |
8173378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University