View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13739_high_8 (Length: 481)
Name: NF13739_high_8
Description: NF13739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13739_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 3e-49; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 31 - 134
Target Start/End: Original strand, 32142852 - 32142955
Alignment:
| Q |
31 |
ggaaaaagtggatctagtggggaagaagatattctgaaggaattaagaggtttagggagtttgtaatgaaagaaggcaccaagatatgggtagaagtagg |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32142852 |
ggaaaaagtggatctagtggggaagaagatattctgaaggaattaagaggtttagggagtttgtaatgaaagaaggcaccaagatatgggtggaagtagg |
32142951 |
T |
|
| Q |
131 |
aacc |
134 |
Q |
| |
|
|||| |
|
|
| T |
32142952 |
aacc |
32142955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 163 - 268
Target Start/End: Original strand, 32142984 - 32143085
Alignment:
| Q |
163 |
ctttagcttttggtctcaagatatatattccaaaaannnnnnnnnnnnnaagtagaatatatgagccaaatctcccccaaatctcagtcttgtattttta |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32142984 |
ctttagcttttggtctcaagatatatattccaaaa----gagagagagaaagtagaatatatgagccaaatctcccccaaatctcagtcttgtattttta |
32143079 |
T |
|
| Q |
263 |
cacggg |
268 |
Q |
| |
|
|||||| |
|
|
| T |
32143080 |
cacggg |
32143085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 380 - 467
Target Start/End: Original strand, 32143197 - 32143291
Alignment:
| Q |
380 |
taaagggtatttataatgcacgggatttgtccctattgcatgtaa-------taaccactatttttaatttttgaagaatactcatgagaataat |
467 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32143197 |
taaagggtatttataatgcacgggatttgtccctattgcatgtaataactattaactactatttttaatttttgaagaatacaaatgagaataat |
32143291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University