View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13739_low_20 (Length: 344)
Name: NF13739_low_20
Description: NF13739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13739_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 13 - 327
Target Start/End: Complemental strand, 6899117 - 6898803
Alignment:
| Q |
13 |
cagagaccacaaacataccaaacaaacacacccaatctctcatagcttccttatacctcctagcgtcaccttcgccagcaccatagtatgtcttccctcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
6899117 |
cagagaccacaaacataccaaacaaacacacccaatctctcatagcttccttatacctcctagcttcaccttcaccagcaccatagtatgtcttccctcc |
6899018 |
T |
|
| Q |
113 |
caccattctcagagcaatattttgtgtcaaatcaccaaaccactgcttcatatcaaccaaaacaccttcttttggacaaccctttatcgaccataaccta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6899017 |
caccattctcagagcaatattttgtgtcaaatcaccaaaccactgcttcatatcaaccaaaacaccttcttttggacaaccctttatcgaccataaccta |
6898918 |
T |
|
| Q |
213 |
taaagctcacttactgcagcttctatctcagatactcttgtgtccttcaacagttcgagtcggtgatttgaaagaagctcaagtgtagctaacttcctta |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
6898917 |
taaagctcacttactgcagcttctatctcagatactcttgtgtccttcaacagttcgagtcggtgattcgaaagaagctcaagtgtagctaatttcctta |
6898818 |
T |
|
| Q |
313 |
tctcacgccaataag |
327 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6898817 |
tctcacgccaataag |
6898803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University