View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13739_low_23 (Length: 268)
Name: NF13739_low_23
Description: NF13739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13739_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 9 - 254
Target Start/End: Complemental strand, 5969179 - 5968934
Alignment:
| Q |
9 |
catcatcacttacatccaatcacgcgttactttctcttacgcgcccgcattttcatagaacattttcttcttacgttgtccggttcgattcagtggttcc |
108 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5969179 |
catcatcacttacatccaatcacgcgctactttctcttacgcgcccgcattttcatagaacattttcttcttacgttgtccggttcggttcagtggttcc |
5969080 |
T |
 |
| Q |
109 |
ggtctgggaaaaacgtgggccgaaagatcttagcggttttaattatgttggttgttatgtcggnnnnnnnnaaggtttcgttgtttattggtggtggtgt |
208 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5969079 |
ggtctggaaaaaacgtgggccgaaagatctttgcggttttaattatgttggttgttatgtcggttttttttaaggtttcgttgtttattggtggtggtgt |
5968980 |
T |
 |
| Q |
209 |
tgaaatgaatgggnnnnnnngtattgaaaatggacaattgattttg |
254 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5968979 |
tgaaatgaatgggaaaaaaagtattgaaaatggacaattgattttg |
5968934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University