View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13739_low_27 (Length: 217)
Name: NF13739_low_27
Description: NF13739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13739_low_27 |
 | |
|
| [»] scaffold0294 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0294 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 16461 - 16646
Alignment:
| Q |
15 |
agcagagaggatatcatatattgggattaagggaaacttgatatcatatctaacaggaccactcaaacaaagcactgcaaaagctgctgaaaatgtgaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||| |
|
|
| T |
16461 |
agcagagaggatatcatatattgggattaagggaaacttgatatcatatctaacaggaccactcaaacaaagcactgcaacagctgctaagaatgtgaat |
16560 |
T |
|
| Q |
115 |
gtttgggctggaactgcttctctacttcctctctttggtgcattcattgctgattcttttcttggacgctatcacacaatcatact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16561 |
atttgggctggaactgcttctctacttcctctcttaggtgctttcgttgctgattcttttcttggacgctatcacacaatcatact |
16646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 200
Target Start/End: Original strand, 11778999 - 11779183
Alignment:
| Q |
16 |
gcagagaggatatcatatattgggattaagggaaacttgatatcatatctaacaggaccactcaaacaaagcactgcaaaagctgctgaaaatgtgaatg |
115 |
Q |
| |
|
||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| | |||||||||| |
|
|
| T |
11778999 |
gcagagaggatgtcatattttggggttaagggaaacttgatatcatatctaacagggccactcaaacaaagcactgcaactgctgctaagaatgtgaatg |
11779098 |
T |
|
| Q |
116 |
tttgggctggaactgcttctctacttcctctctttggtgcattcattgctgattcttttcttggacgctatcacacaatcatact |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11779099 |
tttgggctggaactgcttctctccttcctctctttggtgcattcattgctgattcttttcttggacgctatcacacaatcatact |
11779183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 200
Target Start/End: Original strand, 11797861 - 11798045
Alignment:
| Q |
16 |
gcagagaggatatcatatattgggattaagggaaacttgatatcatatctaacaggaccactcaaacaaagcactgcaaaagctgctgaaaatgtgaatg |
115 |
Q |
| |
|
||||||||| |||||||| ||| ||| | || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11797861 |
gcagagagggtatcatattatggaattcaagggaatttgatatcatatctaacaggaccactcaaacaaagcactgcaaaagctgctgaaaatgtgaatg |
11797960 |
T |
|
| Q |
116 |
tttgggctggaactgcttctctacttcctctctttggtgcattcattgctgattcttttcttggacgctatcacacaatcatact |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
11797961 |
tttgggttggaactgcttctctacttcctctctttggtgctttcattgctgattcttttcttggacgctaccgcacaatcatact |
11798045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 52 - 197
Target Start/End: Original strand, 11696056 - 11696201
Alignment:
| Q |
52 |
ttgatatcatatctaacaggaccactcaaacaaagcactgcaaaagctgctgaaaatgtgaatgtttgggctggaactgcttctctacttcctctctttg |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696056 |
ttgatatcatatctaacaggaccactcaaacaaagcactgcaaaagctgctgaaaatgtgaatatttgggctggaactgcttctctacttcctctctttg |
11696155 |
T |
|
| Q |
152 |
gtgcattcattgctgattcttttcttggacgctatcacacaatcat |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
11696156 |
gtgctttcattgctgattcttttcttggacgctaccgcacaatcat |
11696201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 16 - 200
Target Start/End: Original strand, 11675924 - 11676108
Alignment:
| Q |
16 |
gcagagaggatatcatatattgggattaagggaaacttgatatcatatctaacaggaccactcaaacaaagcactgcaaaagctgctgaaaatgtgaatg |
115 |
Q |
| |
|
||||||||| |||||||| ||||||| | || |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
11675924 |
gcagagagggtatcatattatgggattcaagggaacttgatatcatatctaacaggaccactcaaacaaagcactgcaactgctgctgagaatgtgaata |
11676023 |
T |
|
| Q |
116 |
tttgggctggaactgcttctctacttcctctctttggtgcattcattgctgattcttttcttggacgctatcacacaatcatact |
200 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11676024 |
tttgggctggagttgcttctctccttcctctctttggtgcttttgttgctgattcttttcttggacgctatcgcacaatcatact |
11676108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 16 - 200
Target Start/End: Original strand, 11684203 - 11684387
Alignment:
| Q |
16 |
gcagagaggatatcatatattgggattaagggaaacttgatatcatatctaacaggaccactcaaacaaagcactgcaaaagctgctgaaaatgtgaatg |
115 |
Q |
| |
|
||||||||| |||||||| ||||||| | || |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
11684203 |
gcagagagggtatcatattatgggattcaagggaacttgatatcatatctaacaggaccactcaaacaaagcactgcaactgctgctgagaatgtgaata |
11684302 |
T |
|
| Q |
116 |
tttgggctggaactgcttctctacttcctctctttggtgcattcattgctgattcttttcttggacgctatcacacaatcatact |
200 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11684303 |
tttgggctggagttgcttctctccttcctctctttggtgcttttgttgctgattcttttcttggacgctatcgcacaatcatact |
11684387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 16 - 200
Target Start/End: Original strand, 11701817 - 11702001
Alignment:
| Q |
16 |
gcagagaggatatcatatattgggattaagggaaacttgatatcatatctaacaggaccactcaaacaaagcactgcaaaagctgctgaaaatgtgaatg |
115 |
Q |
| |
|
||||||||| |||||||| ||| ||| | || || |||||||||||||||||||| ||||||||||| |||||||||| ||||||| | ||||| |||| |
|
|
| T |
11701817 |
gcagagagggtatcatattatggaattcaagggaatttgatatcatatctaacagggccactcaaacagagcactgcaacagctgctaagaatgtaaatg |
11701916 |
T |
|
| Q |
116 |
tttgggctggaactgcttctctacttcctctctttggtgcattcattgctgattcttttcttggacgctatcacacaatcatact |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||| || ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11701917 |
tttgggctggaacagcttctctacttcctctcttaggtgcttttgttgctgattcttttcttggacgctatcgcacaatcatact |
11702001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University