View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13739_low_28 (Length: 214)

Name: NF13739_low_28
Description: NF13739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13739_low_28
NF13739_low_28
[»] chr2 (1 HSPs)
chr2 (134-198)||(43763782-43763846)


Alignment Details
Target: chr2 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 134 - 198
Target Start/End: Complemental strand, 43763846 - 43763782
Alignment:
134 attgatttggatttagctggacctgaatactcactgctaatttcctccacacgctcacctcctat 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43763846 attgatttggatttagctggacctgaatactcactgctaatttcctccacacgctcacctcctat 43763782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University