View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1373_high_28 (Length: 203)

Name: NF1373_high_28
Description: NF1373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1373_high_28
NF1373_high_28
[»] chr3 (1 HSPs)
chr3 (31-168)||(14525480-14525612)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 31 - 168
Target Start/End: Original strand, 14525480 - 14525612
Alignment:
31 agatgaacactgtttgtcagaaatgtggcgctatggtttggtatgctgagaggaccggtaaacattatgctgcacttacgccaaaaatttcattgtgttg 130  Q
    ||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14525480 agatgaacactgtttgtcagaaatgtggcg-----gtttggtatgctgagaggaccggtaaacattatgctgcacttacgccaaaaatttcattgtgttg 14525574  T
131 tctaaaagggaagattaagttgacgctcatgttggaac 168  Q
    |||||||||||||||||||||| |||||||||||||||    
14525575 tctaaaagggaagattaagttgccgctcatgttggaac 14525612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University