View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1373_high_6 (Length: 447)
Name: NF1373_high_6
Description: NF1373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1373_high_6 |
 | |
|
| [»] scaffold0135 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 1e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 203 - 401
Target Start/End: Original strand, 9200228 - 9200430
Alignment:
| Q |
203 |
ataccttttctctatcataacttcatgttcgtttctgtttggatcacacaagtttacatacgtagcaatttgatacccaaactcccttgtaaacatagaa |
302 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||| ||| ||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9200228 |
atacctcttctctatcataacttcatgttcgttttcgtttggatcactcaatgttacatatgtagaaatttgatacccaaactcccttgtaaacatagaa |
9200327 |
T |
|
| Q |
303 |
tgtatctttgctgttacctgtttataatttaaacatcaaattaaatgttcgaaataata-----tagcatgaatttttataaatcaaaatccagatctta |
397 |
Q |
| |
|
||||||||||| |||| |||||||| |||||||||||||| |||||||| |||| ||| |||||||| |||||||||| ||||||||| || ||| |
|
|
| T |
9200328 |
ggtatctttgct-ttacatgtttatactttaaacatcaaatcaaatgttcaaaatgatatacagtagcatgagtttttataaaacaaaatccatatatta |
9200426 |
T |
|
| Q |
398 |
ctta |
401 |
Q |
| |
|
|||| |
|
|
| T |
9200427 |
ctta |
9200430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 203 - 298
Target Start/End: Original strand, 9201990 - 9202085
Alignment:
| Q |
203 |
ataccttttctctatcataacttcatgttcgtttctgtttggatcacacaagtttacatacgtagcaatttgatacccaaactcccttgtaaacat |
298 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| ||| ||||||| |||| ||||| |||||||||||||||||||||||| |
|
|
| T |
9201990 |
atacctcttctctatcataacttcatgttcgtttccgtttggatcactcaatgttacatatgtagaaatttaatacccaaactcccttgtaaacat |
9202085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0135 (Bit Score: 64; Significance: 8e-28; HSPs: 1)
Name: scaffold0135
Description:
Target: scaffold0135; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 203 - 298
Target Start/End: Original strand, 72 - 167
Alignment:
| Q |
203 |
ataccttttctctatcataacttcatgttcgtttctgtttggatcacacaagtttacatacgtagcaatttgatacccaaactcccttgtaaacat |
298 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| ||| ||||||| |||| ||||| |||||||||||||||||||||||| |
|
|
| T |
72 |
atacctcttctctatcataacttcatgttcgtttccgtttggatcactcaatgttacatatgtagaaatttaatacccaaactcccttgtaaacat |
167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 51 - 128
Target Start/End: Original strand, 12072961 - 12073037
Alignment:
| Q |
51 |
tgcttaggattgcgaatgactttcttatgcttattttttactgtgatgagaaaaagggcaggtttttgcatacaaaat |
128 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||| || |||||||| |||||||| |||| | ||||||||||||| |
|
|
| T |
12072961 |
tgcttaggattgcaaatgtctttcatatgcttattcttgactgtgataagaaaaagaccagg-tcttgcatacaaaat |
12073037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University