View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1373_low_29 (Length: 270)
Name: NF1373_low_29
Description: NF1373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1373_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 22278370 - 22278120
Alignment:
| Q |
1 |
tgaggaatataggtaaactttctgggtttattcagattatgtttgtttgagtaaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgtt |
100 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22278370 |
tgaggaatataggtaaattttctaggtttattcagattatgtttgtttgagtaaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgtt |
22278271 |
T |
|
| Q |
101 |
gcactgttgggaaaatgatgttggtggatcagggtgattgttgtattgtacgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
22278270 |
gcactgttgggaaaatgatgttggtggatcagggggattgttgtattgtacgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggggt |
22278171 |
T |
|
| Q |
201 |
ctgggagggtcgagttggtggaaagatatcgtgaggattcgtgatgatgtc |
251 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22278170 |
ctgggagggtcgagttggtggaaggatatcgtgaggattcgtgatgatgtc |
22278120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 53 - 129
Target Start/End: Complemental strand, 7287375 - 7287299
Alignment:
| Q |
53 |
aaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggat |
129 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||| |||||| || || | || |||||||| |||||| |||| |
|
|
| T |
7287375 |
aaggaggaaggaggtttgggggtgcggcggttatgtgaatttaatatttcattattaggaaaatggtgttggcggat |
7287299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 53 - 129
Target Start/End: Complemental strand, 7288043 - 7287967
Alignment:
| Q |
53 |
aaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggat |
129 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||| |||||| || || | || |||||||| |||||| |||| |
|
|
| T |
7288043 |
aaggaggaaggaggtttgggggtgcggcggttatgtgaatttaatatttcattattaggaaaatggtgttggcggat |
7287967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 57 - 126
Target Start/End: Original strand, 51072127 - 51072196
Alignment:
| Q |
57 |
aggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtg |
126 |
Q |
| |
|
||||||||||| ||||||| ||| || | || |||||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
51072127 |
aggaaggaggtttgggggtcaggaggatgagggagtttaatgttgctctgttagggaaatggtgttggtg |
51072196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University