View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1373_low_30 (Length: 268)
Name: NF1373_low_30
Description: NF1373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1373_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 16 - 137
Target Start/End: Original strand, 36896050 - 36896171
Alignment:
| Q |
16 |
atgatgtgtaataaaatttccgaaacgcatatgatacactagtattacatttttcttcatttttgcaatttgcattgcattctttcacttgcgttacttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36896050 |
atgatgtgtaataaaatttccgaaacgcatatgatacactagtattgcatttttcttcatttttgcaatttgcattgcattctttcacttgcgttacttc |
36896149 |
T |
|
| Q |
116 |
ttcaatctctctaatcccattc |
137 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36896150 |
ttcaatctctctaatcccattc |
36896171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 223 - 268
Target Start/End: Original strand, 36896253 - 36896298
Alignment:
| Q |
223 |
acccaatggagtgttcctcagaagattcttctgataacactcaaaa |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36896253 |
acccaatggagtgttcctcagaagattcttcagataacactcaaaa |
36896298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 159 - 203
Target Start/End: Original strand, 36896193 - 36896237
Alignment:
| Q |
159 |
aaatgttgaaatcataatctccattttttctaacccagttcaaaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
36896193 |
aaatgttgaaatcataatctccattttttcgaacccaattcaaaa |
36896237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University