View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1373_low_31 (Length: 259)
Name: NF1373_low_31
Description: NF1373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1373_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 122 - 230
Target Start/End: Original strand, 36896519 - 36896627
Alignment:
| Q |
122 |
gagcgttgatggatgattttgtgtgtgtttgtttcaggtggtggaaggatgcacaagatgcaatgccagtggatttggataagaagaaggggattgtata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36896519 |
gagcgttgatggatgattttgtgtgtgtttgtttcaggtggtggaaggatgcacaagatgcaatgccagtggatttggataagaagaaggggattgtata |
36896618 |
T |
 |
| Q |
222 |
tgcatcttc |
230 |
Q |
| |
|
||||||||| |
|
|
| T |
36896619 |
tgcatcttc |
36896627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 141 - 230
Target Start/End: Original strand, 24192092 - 24192177
Alignment:
| Q |
141 |
tgtgtgtgtttgtttcaggtggtggaaggatgcacaagatgcaatgccagtggatttggataagaagaaggggattgtatatgcatcttc |
230 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
24192092 |
tgtgtgtgtttgtttcaggtggtagaaggatgcacaa----caatgctagtggatttggaaaagaagaaggggattgtatatccatcttc |
24192177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University