View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1373_low_32 (Length: 253)
Name: NF1373_low_32
Description: NF1373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1373_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 29 - 168
Target Start/End: Complemental strand, 14525614 - 14525480
Alignment:
| Q |
29 |
aggttccaacatgagcggcaacttaatcttcccttttagacaacacaatgaaatttttggcgtaagtgcagcataatgtttaccggtcctctcagcatac |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14525614 |
aggttccaacatgagcggcaacttaatcttcccttttagacaacacaatgaaatttttggcgtaagtgcagcataatgtttaccggtcctctcagcatac |
14525515 |
T |
|
| Q |
129 |
caaaccatagcgccacacttctgacaaactgtgttcatct |
168 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
14525514 |
caaac-----cgccacatttctgacaaacagtgttcatct |
14525480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University