View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1373_low_34 (Length: 253)
Name: NF1373_low_34
Description: NF1373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1373_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 42 - 243
Target Start/End: Original strand, 40183459 - 40183663
Alignment:
| Q |
42 |
ccgtcgacaacaatggtcatggctattagagaatcatatctatgccnnnnnnnn---actaaagaatcatatgtatgacatagatgatcaaattttctca |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
40183459 |
ccgtcgacaacaatggtcatggctattagagaatcatatctatgcctttttttttttactaaagaatcatatgtatgatatagataatcaaattttctca |
40183558 |
T |
 |
| Q |
139 |
ttgtacgaattgtgatttgagtttaagtatgaaattcttctattagtaggtcatacgtaaatttttgtcgtaaaccctcaccgtgattgattttttctct |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40183559 |
ttgtacgaattgtgatttgagtttgagtatgaaattcttctattagtaggtcatacgtaaatttttgtcgtaaaccctcaccgtgattgattttttctct |
40183658 |
T |
 |
| Q |
239 |
ctctg |
243 |
Q |
| |
|
||||| |
|
|
| T |
40183659 |
ctctg |
40183663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University