View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1373_low_6 (Length: 468)
Name: NF1373_low_6
Description: NF1373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1373_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 423; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 423; E-Value: 0
Query Start/End: Original strand, 29 - 463
Target Start/End: Original strand, 46599008 - 46599442
Alignment:
| Q |
29 |
atcttccacaccattccccggaggagcaagagtcaacgcagtcaacggatcatcttccaccggaaaagtaaactgaccaccttcgttgccacctccagca |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599008 |
atcttccacaccattccccggaggagcaagagtcaacgcggtcaacggatcatcttccaacggaaaagtaaactgaccaccttcgttgccacctccagca |
46599107 |
T |
|
| Q |
129 |
accgtaacagaaccaccacaacccgctctacgcttaagcgtagagttccaatgattcttgacagcattatcagttctaccaggtaaaagccttgcaatgg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599108 |
accgtaacagaaccaccacaacccgctctacgcttaagcgtagagttccaatgattcttgacagcattatcagttctaccaggtaaaagccttgcaatgg |
46599207 |
T |
|
| Q |
229 |
tagcccaacggttaccatattgagcatgcgccgctatgattgtttcatcttcttgtgaagaaaatggacggtgttccacggtgggactcagctgattaca |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599208 |
tagcccaacggttaccatattgagcatgcgccgctatgattgtttcatcttcttgtgaagaaaatggacggtgttccacggtgggactcagctgattaca |
46599307 |
T |
|
| Q |
329 |
ccaccggagacgacatgacttgccggaacgaccttttatgtagcggctgatgagtgaccagtttcttgctccatgttgttcaaccagtcgtgttaaaatt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599308 |
ccaccggagacgacatgacttgccggaacgaccttttatgtagcggctgatgagtgaccagtttcttgctccatgttgttcaaccagtcgtgttaaaatt |
46599407 |
T |
|
| Q |
429 |
ctgtcttcttctgcactccatggacctttgcttct |
463 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
46599408 |
ctgtcttcttctgcactccatggacctttgattct |
46599442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 40752008 - 40752055
Alignment:
| Q |
176 |
ccaatgattcttgacagcattatcagttctaccaggtaaaagccttgc |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
40752008 |
ccaatgattcttcacagcattatcagttctaccagggaaaagtcttgc |
40752055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 361
Target Start/End: Complemental strand, 35748041 - 35747986
Alignment:
| Q |
306 |
acggtgggactcagctgattacaccaccggagacgacatgacttgccggaacgacc |
361 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| ||||| || || |||||||| |
|
|
| T |
35748041 |
acggttggactcagctgattacaccaccgtagacggcatgattttcctgaacgacc |
35747986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 226
Target Start/End: Original strand, 31791021 - 31791067
Alignment:
| Q |
180 |
tgattcttgacagcattatcagttctaccaggtaaaagccttgcaat |
226 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| |||||||| ||||| |
|
|
| T |
31791021 |
tgattcttaacagcattatcagttcttccagggaaaagcctagcaat |
31791067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University