View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1373_low_8 (Length: 452)
Name: NF1373_low_8
Description: NF1373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1373_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 36 - 375
Target Start/End: Complemental strand, 53767551 - 53767212
Alignment:
| Q |
36 |
aataatatatataaaccaatgttttgtaaactaactaactattgtctcctcacaaagaaaaatcaaccccttatcctcacaaagaagttgtgtcccgcta |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53767551 |
aataatatatataaaccaatgttttgtaaactaactaactattgtctcctcacaaagaaaaatcaaccccttatcctcacaaagaagttgtgtcccgcta |
53767452 |
T |
|
| Q |
136 |
ctatgaatttcatcggtgaatattttatcgtgttatatctgtcgccttctccaaccgatccctgagtttcaacttttttgtcgcagaatcaaccaaaatt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53767451 |
ctatgaatttcatcggtgaatattttatcgtgttatatctgttgccttctccaaccgatccctgagtttcaacttttttgtctcagaatcaaccaaaatt |
53767352 |
T |
|
| Q |
236 |
caaataacggactgtgcaatgtaacttttgtttggtttaactgtgtactataggtagaggctgtccagggaaatatgattttgctttctggtgtggacct |
335 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53767351 |
caaatgacggactgtgcaatgtaacttttgtttggtttaactgtgtactataggtagaggctgtccagggaaatatgattttgctttctggtgtggacct |
53767252 |
T |
|
| Q |
336 |
ggttgatggaactgtaagtttccattttctaatctctgct |
375 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53767251 |
ggttgatggaactgtaagtctccattttctaatctctgct |
53767212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University