View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1374-INSERTION-4 (Length: 201)
Name: NF1374-INSERTION-4
Description: NF1374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1374-INSERTION-4 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 6e-33; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 114 - 201
Target Start/End: Complemental strand, 41825022 - 41824935
Alignment:
| Q |
114 |
tttgagatcaactaactataatggacgatagcaaaatacttttaaacttaatccatatgctcgcctcagtcaataaatttgataagta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825022 |
tttgagatcaactaactataatggacgatagcaagatgcttttaaacctaatacatatgctcgcctcagtcaataaatttgataagta |
41824935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 41826475 - 41826435
Alignment:
| Q |
8 |
ggatcagtgtgaagaagatacaaaatacacgtaagttgctg |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41826475 |
ggatcagtgtgaagaagatacaaaatacacgtaagttgctg |
41826435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 48 - 87
Target Start/End: Complemental strand, 41826361 - 41826322
Alignment:
| Q |
48 |
gaagtataatggcttcttccatctcttatttatttatttt |
87 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
41826361 |
gaagtataatggcttcatcaatctcttatttatttatttt |
41826322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University