View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13740_high_14 (Length: 207)
Name: NF13740_high_14
Description: NF13740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13740_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 48397646 - 48397469
Alignment:
| Q |
16 |
gaagaactgttttttgagcttttgaaggtggaccttcggtgggaatgaagaaggagatttgaagattttgattaagaataataattcttttggcaaattc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397646 |
gaagaactgttttttgagcttttgaaggtggaccttcggtgggaatgaagaaggtgatttgaagattttgattaagaataataattcttttggcaaattc |
48397547 |
T |
 |
| Q |
116 |
aatcattggtataagatgtcccatgcctggtgatggtagcatcaccaccataggtggtggtttagataatggttcttg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397546 |
aatcattggtataagatgtcccatgcctggtgatggtagcataaccaccataggtggtggtttagataatggttcttg |
48397469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University