View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13740_high_15 (Length: 204)
Name: NF13740_high_15
Description: NF13740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13740_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 31998842 - 31998672
Alignment:
| Q |
18 |
gatagtcacttctatgttaattcactaatatcaaccatcattttaattaacgattctaacatcaagtagtactaaatcaaagtctctaatcacaaaaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31998842 |
gatagtcacttctatgttaattcactaacatcaaccatcattttaattaacgattctaacgtcaagtagtactaaatcaaagtctctaatcacaaaaatg |
31998743 |
T |
 |
| Q |
118 |
atattagccttttttcgtaatttgatacttaacaattgtcatgggtagataataatcattaaaactcaatct |
189 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31998742 |
atatta-ccttttttcgtaatttgatacttaacaattgtcatgggtagataataatcattaaaactcaatct |
31998672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University