View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13740_low_13 (Length: 299)
Name: NF13740_low_13
Description: NF13740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13740_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 16 - 282
Target Start/End: Original strand, 26130238 - 26130504
Alignment:
| Q |
16 |
atggatagatacagaacatgcacaaataccagacatattaataatatcaatcaagtataattaaaaaatactaagcctccaattacagatattaaacatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26130238 |
atggatagatacagaacatgcacaaataccagacatattaataatatcaatcaagtataattaaaaaatactaagcctccaattacagatattaaacatt |
26130337 |
T |
 |
| Q |
116 |
cacttacataatcattctcagagttgtacgaatcctcgtgttcttgaatttcatcttcagttgtcattggagattgtgtctgcccaacattgatgtgact |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26130338 |
cacttacataatcattctcagagttgtacgaatcctcgtgttcctgaatttcatcttcagttgaaattggagattgtgtctgcccaacattgatgtgact |
26130437 |
T |
 |
| Q |
216 |
gatgcaagcaaacttggaccaccttggcataaccaagcactttggaagatcatcaaaatcaagatac |
282 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26130438 |
gatgcaagcaaacttggaccacctaggcataaccaagcactttggaagatcatcaaaatcaagatac |
26130504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 221 - 282
Target Start/End: Complemental strand, 11011150 - 11011089
Alignment:
| Q |
221 |
aagcaaacttggaccaccttggcataaccaagcactttggaagatcatcaaaatcaagatac |
282 |
Q |
| |
|
|||||||||||||||||||| ||| |||||| || ||||||||||||||||||||||||||| |
|
|
| T |
11011150 |
aagcaaacttggaccacctttgcaaaaccaaacattttggaagatcatcaaaatcaagatac |
11011089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University