View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13741_high_24 (Length: 217)
Name: NF13741_high_24
Description: NF13741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13741_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 181
Target Start/End: Original strand, 8636647 - 8636810
Alignment:
| Q |
17 |
aatatggaaaacattggtggtgggtttcattttttgctgtttacgtctctcagcaggttggtttttggtttacttttgcaccttgaacatgtttgatgaa |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
8636647 |
aatatggaaaactttggtggtgggtttcattttttgctgtttacgtctctcagcaggttggtttttggtttactttagcaacttgaacatgtttgatgaa |
8636746 |
T |
|
| Q |
117 |
ttgtctgtttggtttaatttttggggtaaataatcaatttggtccctgaaattgtagaactgtat |
181 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8636747 |
ttgtctgtttggtttaattttt-ggataaataatcaatttggtccctgaaattgtagaactgtat |
8636810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 135 - 173
Target Start/End: Original strand, 3114967 - 3115005
Alignment:
| Q |
135 |
ttttggggtaaataatcaatttggtccctgaaattgtag |
173 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3114967 |
ttttggggtaaatactcaatttggtccctgaaattgtag |
3115005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University