View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13741_low_16 (Length: 323)
Name: NF13741_low_16
Description: NF13741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13741_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 2503465 - 2503287
Alignment:
| Q |
1 |
ttgatatcgatgaagctatgaagcaaagaattccagctaccaccaaagggactgagatttgcaactgtgattcatggaatccttgtgtaacattttttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2503465 |
ttgatatcgatgaagctatgaagcaaagaattccagctaccaccaaagggactgagatttgcaactgtgattcatggaatccttgtgtaacattttttag |
2503366 |
T |
 |
| Q |
101 |
ctgagaaattttgtctagaacatggttaatattgagtatagttgaaaagggctttgtttgttttgcatttgaaggattg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2503365 |
ctgagaaattttgtctagaacatggttaatattgagtatagttgaaaagggctttgtttgttttgcatttgaaggattg |
2503287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 209 - 302
Target Start/End: Complemental strand, 2503257 - 2503164
Alignment:
| Q |
209 |
tataatactttcagttctcattttgcttttgagagaattttagcaatgataaagagtgaagtagtgaggttaggtgtgtatatgctgattggca |
302 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2503257 |
tataatacttttagttctcattttgcttttgagagaattttagcaatgataaagagtgaagtagtgaggttaggtgtgtatatgctgattggca |
2503164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University