View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13741_low_23 (Length: 256)
Name: NF13741_low_23
Description: NF13741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13741_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 15 - 206
Target Start/End: Complemental strand, 47117128 - 47116941
Alignment:
| Q |
15 |
gacatcatcaccggcgaagatggtgatgttggcgttcccgttgagctttgttgcctatcatacattctccgcctatccatctacaaaacaagaaattaaa |
114 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47117128 |
gacatcatcaccggtgaagacggtgatgttggcgttcccgttgagctttgttgcctatcatacattctccgcctatccatctacaaaacaagaaattaaa |
47117029 |
T |
 |
| Q |
115 |
aataatcgttaaaaggtgatcgatcgagtcattgatacgttgatattgcttaccttgctttgtgatttgatcgttaaaaggtatgaatattt |
206 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47117028 |
aataatcgttaaaaggtga----tcgagtcattgatacgttgatattgcttaccttgctttgtgatttgatcgttaaaaggtatgaatattt |
47116941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University