View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13741_low_31 (Length: 205)
Name: NF13741_low_31
Description: NF13741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13741_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 13 - 113
Target Start/End: Complemental strand, 35163684 - 35163584
Alignment:
| Q |
13 |
cataggtaggtctgaaacagagagtttaaggtttgctatgttggatttttggtctggggttatggtacattttgagaccaaggttggagatgaagaaggc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163684 |
cataggtaggtctgaaacagagagtttaaggtttgctatgttggatttttggtctggggttatggtacattttgagaccaaggttggagatgaagaaggc |
35163585 |
T |
 |
| Q |
113 |
a |
113 |
Q |
| |
|
| |
|
|
| T |
35163584 |
a |
35163584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University