View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13743_high_1 (Length: 549)
Name: NF13743_high_1
Description: NF13743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13743_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 436; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 436; E-Value: 0
Query Start/End: Original strand, 87 - 530
Target Start/End: Complemental strand, 46901506 - 46901063
Alignment:
| Q |
87 |
gcccacgttttcattgagcctagcagccgcagcaacagaagcagctacaccaccaggagtagcagtagcatcaggattattcctcatctcagcactagcc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901506 |
gcccacgttttcattgagcctagcagccgcagcaacagaagcagctacaccaccaggagtagcagtagcatcaggattattcctcatctcagcactagcc |
46901407 |
T |
|
| Q |
187 |
accccagcagcatcttgccttgtcgccgccttatcagctggcagcttcgctgttgctccggtcagaacatctcccatcttaatcttctcctcctcacgtt |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901406 |
accccagcagcatcttgccttgtcgccgccttatcagctggcagcttcgctgttgctccggtcagaacatctcccatcttaatcttctcctcctcacgtt |
46901307 |
T |
|
| Q |
287 |
gacactcagcattgaaagctgctgcagattgagccattgaagccaaacctcccggtgttataatattactccccgtagctctcacctccgccgcttgtat |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901306 |
gacactcagcattgaaagctgctgcagattgagccattgaagccaaacctcccggtgttataacattactccccgtagctctcacctccgccgcttgtat |
46901207 |
T |
|
| Q |
387 |
cgcagaggcgtcactctgttccaccggcttgtcacccaccgtgtgggccgtcgcctctagtgcctctccgatggttaatgcactctctcgaaccgcaccg |
486 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901206 |
cgcagaggcgtcactctgttccaccggcttgtcgcccaccgtgtgggccgtcgcctctagtgcctctccgatggttaatgcactctctcgaaccgcaccg |
46901107 |
T |
|
| Q |
487 |
gttagaccaacttgaactggagtcggttcaacaaattgtcccac |
530 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901106 |
gttagaccaacttgaactggagtcggttcaacaaattgtcccac |
46901063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University