View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13743_high_10 (Length: 348)
Name: NF13743_high_10
Description: NF13743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13743_high_10 |
 | |
|
| [»] scaffold0077 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 340
Target Start/End: Complemental strand, 46221375 - 46221037
Alignment:
| Q |
1 |
ttggggaaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221375 |
ttggggaaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaa |
46221276 |
T |
|
| Q |
101 |
cagacgcgtgaagttccgatcaggtctccacgcgctagtcctttgcctggatatctcacgcgcggttgaattcaatcgctaaattctaggtttgctaggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46221275 |
cagacgcgtgaagttccgatcaggtctccacgcgctagtcctttgcctggatatctcacgcgcggttgaattcaatcgctaaattctaggtttgttaggg |
46221176 |
T |
|
| Q |
201 |
agttgatgaaattactagattgatatgcacgtgatctgtgatcgatcgcacgtgtatttttagatttacttcgtgtgtttgcttataagaattgaaaatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
46221175 |
agttgatgaaattactagattgatatgcacgtgatctgtgatcgatcgcacgtgtatttttagatttacttcgtgtttttgcttataagaattgaaaa-t |
46221077 |
T |
|
| Q |
301 |
ttagaagtaatcgcgtgtggttgtttgttagttgatgatg |
340 |
Q |
| |
|
|||||| |||| | ||||| |||||||||||||||||||| |
|
|
| T |
46221076 |
ttagaattaatagagtgtgtttgtttgttagttgatgatg |
46221037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 7 - 144
Target Start/End: Original strand, 29830997 - 29831134
Alignment:
| Q |
7 |
aaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaacagacg |
106 |
Q |
| |
|
||||| ||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||| || || ||| | || ||||||||||| | ||| || |
|
|
| T |
29830997 |
aaacgacggtgtttggcagaaggagatattgatgggaggaaaatgtgagccgttggatttctcaggcgttattcattatgatattaacggaagacaaacc |
29831096 |
T |
|
| Q |
107 |
cgtgaagttccgatcaggtctccacgcgctagtccttt |
144 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||| |
|
|
| T |
29831097 |
ggtgaagttcctctcaggtctccacgcgctattccttt |
29831134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0077 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0077
Description:
Target: scaffold0077; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 17 - 103
Target Start/End: Complemental strand, 10521 - 10435
Alignment:
| Q |
17 |
gtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaacag |
103 |
Q |
| |
|
||||||||||| ||| |||||||| | |||||||| |||||||||||||| ||||||||||| || || | ||| ||||||||| |
|
|
| T |
10521 |
gtttggcagaaaacgatcttgatgggtgataagtgtgaaccgttggatttctctggtgtgatttattatgacaataaggggaaacag |
10435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University