View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13743_high_13 (Length: 304)
Name: NF13743_high_13
Description: NF13743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13743_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 81 - 287
Target Start/End: Original strand, 34224554 - 34224759
Alignment:
| Q |
81 |
gctacatgtgattcatgaccatatgatatatgatcaatgatcatcatcatatcataaaataaatatttaaattctatctaaacnnnnnnngtgccaacca |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34224554 |
gctacatgtgattcatgaccatatgatatatgatcaatgatcatcatcatatcatagaataaatatttaaattctatctaaacttttttt-tgccaacca |
34224652 |
T |
 |
| Q |
181 |
aatttgattcatatggtcaacaccatgtactataaataagaccaacnnnnnnncaactcaactatataatcaaaacttgcttaaacttattcttatatag |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34224653 |
aatttgattcatatggtcaacaccatgtactataaataagaccaactttttttcaactcaactatataatcaaaacttgcttaaacttattcttatatag |
34224752 |
T |
 |
| Q |
281 |
ctttttc |
287 |
Q |
| |
|
||||||| |
|
|
| T |
34224753 |
ctttttc |
34224759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University