View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13743_high_16 (Length: 228)
Name: NF13743_high_16
Description: NF13743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13743_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 6 - 187
Target Start/End: Complemental strand, 46221582 - 46221401
Alignment:
| Q |
6 |
actctcacgaaaagctaaccgattaaaagaaaaagcaaaatcatcatcgacgacgaaaccgatcagagacgaggagtggaggttcgatcttaagacaccg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221582 |
actctcacgaaaagctaaccgattaaaagaaaaagcaaaatcatcatcgacgacgaaaccgatcagagacgaggagtggaggttcgatcttaagacaccg |
46221483 |
T |
|
| Q |
106 |
ccgaaatcaccgatggcgaaaccgaagaagttgctgagcaatataagcaacaaagcactgtcgcaattcgggaagaagaagc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221482 |
ccgaaatcaccgatggcgaaaccgaagaagttgctgagcaatataagcaacaaagcactgtcgcaattcgggaagaagaagc |
46221401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 120 - 186
Target Start/End: Original strand, 29830901 - 29830967
Alignment:
| Q |
120 |
ggcgaaaccgaagaagttgctgagcaatataagcaacaaagcactgtcgcaattcgggaagaagaag |
186 |
Q |
| |
|
||||||| ||||||| ||||||||||| || ||||||||||| |||| ||||||||||||| |||| |
|
|
| T |
29830901 |
ggcgaaaacgaagaaattgctgagcaacatgagcaacaaagctttgtcacaattcgggaagatgaag |
29830967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University