View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13743_low_16 (Length: 285)
Name: NF13743_low_16
Description: NF13743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13743_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 10 - 267
Target Start/End: Complemental strand, 27418 - 27161
Alignment:
| Q |
10 |
aagaatattgctattatcttctaagggtctgtatgaactccttggccatgaagaacaaccctccaatatggaatgggagatatcaaccatgatttgtctg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27418 |
aagaatattgctattatcttctaagggtctgtatgaactccttggccatgaagaacaaccctccaatatggaatgggagatatcagccatgatttgtctg |
27319 |
T |
 |
| Q |
110 |
gcggagaaggcctctaaaatcatcagcaggaaacctatagaaacctgcaaacagaatttagtcatccaagaaagttgacattatgattgttaagtatcta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27318 |
gcggagaaggcctctaaaatcatcagcaggaaacctatagaaacctgcaaacagaatttagtcatccaaaaaagttgacattatgattgttaagtatcta |
27219 |
T |
 |
| Q |
210 |
ggaaaaaatgaaatgacaattttcatctattttctttattttcatgtctgcactctgt |
267 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27218 |
ggaaaaaatgaaatgataattttcatctattttctttattttcatgtctgcactctgt |
27161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University