View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13743_low_19 (Length: 228)

Name: NF13743_low_19
Description: NF13743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13743_low_19
NF13743_low_19
[»] chr4 (2 HSPs)
chr4 (6-187)||(46221401-46221582)
chr4 (120-186)||(29830901-29830967)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 6 - 187
Target Start/End: Complemental strand, 46221582 - 46221401
Alignment:
6 actctcacgaaaagctaaccgattaaaagaaaaagcaaaatcatcatcgacgacgaaaccgatcagagacgaggagtggaggttcgatcttaagacaccg 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46221582 actctcacgaaaagctaaccgattaaaagaaaaagcaaaatcatcatcgacgacgaaaccgatcagagacgaggagtggaggttcgatcttaagacaccg 46221483  T
106 ccgaaatcaccgatggcgaaaccgaagaagttgctgagcaatataagcaacaaagcactgtcgcaattcgggaagaagaagc 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46221482 ccgaaatcaccgatggcgaaaccgaagaagttgctgagcaatataagcaacaaagcactgtcgcaattcgggaagaagaagc 46221401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 120 - 186
Target Start/End: Original strand, 29830901 - 29830967
Alignment:
120 ggcgaaaccgaagaagttgctgagcaatataagcaacaaagcactgtcgcaattcgggaagaagaag 186  Q
    ||||||| ||||||| ||||||||||| || |||||||||||  |||| ||||||||||||| ||||    
29830901 ggcgaaaacgaagaaattgctgagcaacatgagcaacaaagctttgtcacaattcgggaagatgaag 29830967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University