View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13743_low_20 (Length: 211)
Name: NF13743_low_20
Description: NF13743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13743_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 4674775 - 4674953
Alignment:
| Q |
15 |
aatactatggctgtaactggtgatgctttaagagatggatcacttggcttgttaaaaccatttgtaacaatgtccactgcatttagagttgcaattgcag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4674775 |
aatactatggctgtaactggtgatgctttaagagatggatcacttggcttgttaaaaccatttgtaacaatgtccactgcatttagagttgcaattgcag |
4674874 |
T |
 |
| Q |
115 |
cacctaaactgtgacctgttatagttatgcttatttcttcattcttgtatttttccactaaccttcttacctcacttaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
4674875 |
cacctaaactgtgacctgttatagttatgcttatttcttcattcttgtatttctccaccaaccttcttacctcacttaa |
4674953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 87 - 164
Target Start/End: Original strand, 34548233 - 34548310
Alignment:
| Q |
87 |
tccactgcatttagagttgcaattgcagcacctaaactgtgacctgttatagttatgcttatttcttcattcttgtat |
164 |
Q |
| |
|
||||||| | ||| |||||||| |||| |||| |||||||| || |||| ||||||||| |||||||||||||||||| |
|
|
| T |
34548233 |
tccactgaacttatagttgcaagtgcaccacccaaactgtgtccagttacagttatgctaatttcttcattcttgtat |
34548310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University