View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13744_high_12 (Length: 258)
Name: NF13744_high_12
Description: NF13744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13744_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 3e-20; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 24734080 - 24734018
Alignment:
| Q |
115 |
taaagcatcacagttttgttcgaaagtttcacaacacttcctacgtcacatattttccatcag |
177 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
24734080 |
taaagcatcacagttttgttcgaaagttggacaacactttctacgtcacatattttccatcag |
24734018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 53343155 - 53343106
Alignment:
| Q |
17 |
aggtagtccaccgatgaaccatttacttgatggttcatcctagaatccac |
66 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
53343155 |
aggtggtccaccgatgaaccacttatttgatggttcatcctagaatccac |
53343106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 66
Target Start/End: Complemental strand, 45781595 - 45781551
Alignment:
| Q |
22 |
gtccaccgatgaaccatttacttgatggttcatcctagaatccac |
66 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
45781595 |
gtccaccggtgaaccatttgtttgatggttcaccctagaatccac |
45781551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 52717724 - 52717760
Alignment:
| Q |
30 |
atgaaccatttacttgatggttcatcctagaatccac |
66 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
52717724 |
atgaaccatttagttgatggttcaccctagaatccac |
52717760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 65
Target Start/End: Original strand, 21838252 - 21838295
Alignment:
| Q |
22 |
gtccaccgatgaaccatttacttgatggttcatcctagaatcca |
65 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
21838252 |
gtccaccgatgaaccacttaattgatggttcatcctagaatcca |
21838295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 38558996 - 38558947
Alignment:
| Q |
17 |
aggtagtccaccgatgaaccatttacttgatggttcatcctagaatccac |
66 |
Q |
| |
|
|||| |||||||||||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
38558996 |
aggtggtccaccgatgaaccacttatttaatggttcatcctagaatccac |
38558947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 66
Target Start/End: Original strand, 40600660 - 40600704
Alignment:
| Q |
22 |
gtccaccgatgaaccatttacttgatggttcatcctagaatccac |
66 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| ||||||| |
|
|
| T |
40600660 |
gtccaccgatgaaccacttatttgatggttcatcctaaaatccac |
40600704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 66
Target Start/End: Original strand, 22297899 - 22297943
Alignment:
| Q |
22 |
gtccaccgatgaaccatttacttgatggttcatcctagaatccac |
66 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
22297899 |
gtccaccgatgaaccacttaattgatggttcactctagaatccac |
22297943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 66
Target Start/End: Original strand, 1522396 - 1522440
Alignment:
| Q |
22 |
gtccaccgatgaaccatttacttgatggttcatcctagaatccac |
66 |
Q |
| |
|
|||||||| ||||||| || |||||||||||||||||||||||| |
|
|
| T |
1522396 |
gtccaccggtgaaccacttgtttgatggttcatcctagaatccac |
1522440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University